NameSperm protamine P1
Synonyms
  • Cysteine-rich protamine
Gene NamePRM1
OrganismHuman
Amino acid sequence
>lcl|BSEQ0013453|Sperm protamine P1
MARYRCCRSQSRSRYYRQRQRSRRRRRRSCQTRRRAMRCCRPRYRPRCRRH
Number of residues51
Molecular Weight6822.9
Theoretical pINot Available
GO Classification
Functions
  • DNA binding
Processes
  • DNA packaging
  • cell differentiation
  • multicellular organismal development
  • spermatogenesis
  • chromosome condensation
Components
  • nucleoplasm
  • nucleosome
General FunctionDna binding
Specific FunctionProtamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex.
Pfam Domain Function
Transmembrane RegionsNot Available
GenBank Protein IDNot Available
UniProtKB IDP04553
UniProtKB Entry NameHSP1_HUMAN
Cellular LocationNucleus
Gene sequence
>lcl|BSEQ0013454|Sperm protamine P1 (PRM1)
ATGGCCAGGTACAGATGCTGTCGCAGCCAGAGCCGGAGCAGATATTACCGCCAGAGACAA
AGAAGTCGCAGACGAAGGAGGCGGAGCTGCCAGACACGGAGGAGAGCCATGAGGTGCTGC
CGCCCCAGGTACAGACCGCGATGTAGAAGACACTAA
GenBank Gene IDNot Available
GeneCard IDNot Available
GenAtlas IDNot Available
HGNC IDHGNC:9447
Chromosome Location16
LocusNot Available
References
  1. Domenjoud L, Nussbaum G, Adham IM, Greeske G, Engel W: Genomic sequences of human protamines whose genes, PRM1 and PRM2, are clustered. Genomics. 1990 Sep;8(1):127-33. 2081589
  2. Krawetz SA, Herfort MH, Hamerton JL, Pon RT, Dixon GH: Chromosomal localization and structure of the human P1 protamine gene. Genomics. 1989 Oct;5(3):639-45. 2613245
  3. Lee CH, Hoyer-Fender S, Engel W: The nucleotide sequence of a human protamine 1 cDNA. Nucleic Acids Res. 1987 Sep 25;15(18):7639. 3658707
  4. Nelson JE, Krawetz SA: Characterization of a human locus in transition. J Biol Chem. 1994 Dec 9;269(49):31067-73. 7983046
  5. Queralt R, de Fabregues-Boixar O, Adroer R, Gene M, Gomez-Catalan J, Huguet E, Oliva R: Direct sequencing of the human protamine P1 gene and application in forensic medicine. J Forensic Sci. 1993 Nov;38(6):1491-501. 8263493
  6. Wyckoff GJ, Wang W, Wu CI: Rapid evolution of male reproductive genes in the descent of man. Nature. 2000 Jan 20;403(6767):304-9. 10659848
  7. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. 15489334
  8. McKay DJ, Renaux BS, Dixon GH: The amino acid sequence of human sperm protamine P1. Biosci Rep. 1985 May;5(5):383-91. 4027356
  9. Ammer H, Henschen A, Lee CH: Isolation and amino-acid sequence analysis of human sperm protamines P1 and P2. Occurrence of two forms of protamine P2. Biol Chem Hoppe Seyler. 1986 Jun;367(6):515-22. 3527226
  10. Papoutsopoulou S, Nikolakaki E, Chalepakis G, Kruft V, Chevaillier P, Giannakouros T: SR protein-specific kinase 1 is highly expressed in testis and phosphorylates protamine 1. Nucleic Acids Res. 1999 Jul 15;27(14):2972-80. 10390541